View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6109_high_9 (Length: 251)
Name: NF6109_high_9
Description: NF6109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6109_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 38438759 - 38438522
Alignment:
| Q |
1 |
tgtgatggcggttaggttcatacctcgttgtcaaatagtttggtctgttattattccctttttacactgtcttcnnnnnnngcaatttagttgtggttcc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
38438759 |
tgtgatgacggttaggttcatacctcgttgtcaaatagtttggtctgttattattccgtttttacactgtcttctttttttgcaatttagttgtggttcg |
38438660 |
T |
 |
| Q |
101 |
gcaagcggatccgctagattgtgcaagctcagctgtgtgagattgtttttctggacaaggatgagtattttatacttcctagggttgatttgtttcaccc |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
38438659 |
gtaagcggatccgctagattgtgcaagctcatctgtgtgagattgtttttctggacaaggatgagtgttttatacttcctagggttgatttgtatcaccc |
38438560 |
T |
 |
| Q |
201 |
atttgagtttgttttttgtcattgggtcgatcaggtct |
238 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
38438559 |
atttgagtttgttttttgtcactggatcgatcaggtct |
38438522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University