View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6109_low_12 (Length: 207)
Name: NF6109_low_12
Description: NF6109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6109_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 14705457 - 14705277
Alignment:
| Q |
15 |
atgaataaaaataaaataccaactacccaaataattaactcataatcccaattcgacaagattattattgtacctaagaaaattgatcttaaccaggaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14705457 |
atgaataaaaataaaataccaactacccaaataattaactcataatcccaattcgacaagattattattgtacctaagaaaattgatcttaaccaagaac |
14705358 |
T |
|
| Q |
115 |
cacttattaggtgcaaagctcacgagcaataccaattcttgagttgggtacatcaaatagcacacggtggttttgttgttg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705357 |
cacttattaggtgcaaagctcacgagcaataccaattcttgagttgggtacatcaaatagcacacggtggttttgttgttg |
14705277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 192
Target Start/End: Original strand, 4035531 - 4035605
Alignment:
| Q |
118 |
ttattaggtgcaaagctcacgagcaataccaattcttgagttgggtacatcaaatagcacacggtggttttgttg |
192 |
Q |
| |
|
|||||| || || ||||||||||||| ||||| || ||||| || |||||| | |||||||||||||||||||| |
|
|
| T |
4035531 |
ttattaagtacatagctcacgagcaacaccaaccctagagttagggacatcatagagcacacggtggttttgttg |
4035605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University