View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6110_low_4 (Length: 232)
Name: NF6110_low_4
Description: NF6110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6110_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 220
Target Start/End: Complemental strand, 8683616 - 8683420
Alignment:
| Q |
24 |
gttacagatactaacctgacagcatttctccnnnnnnnnnnnnntccaatagccatttggaaacttgaacttatgatcaaagcaccttgaatccctctca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683616 |
gttacagatactaacctgacagcatttctccaaaaaccaaaaaatccaatagccatttggaaacttgaacttatgatcaaagcaccttgaatccctctca |
8683517 |
T |
|
| Q |
124 |
ttgtcatagtaaacctctaggaaattcaaacaaacatgtagacaaagtcagcaaaatgaaaacgctaaagagtgaaacattttccatttataacatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683516 |
ttgtcatagtaaacctctaggaaattcaaacaaacatgtagacaaagtcagcaaaatgaaaacgctaaagagtgaaacattttccatttataacatg |
8683420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University