View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6111_high_2 (Length: 426)
Name: NF6111_high_2
Description: NF6111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6111_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Original strand, 1674271 - 1674678
Alignment:
| Q |
1 |
catcagacagttcaatttatatgtgcctgatcttctcttctttggtggatcattcacttcaaggccagagaggacagagtcttttcaagctttgtgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1674271 |
catcagacagttcaatttatatgtgcctgatcttctcttctttggtggatcattcacttcaaggccagagaggacagagtcttttcaagctttgtgtttg |
1674370 |
T |
 |
| Q |
101 |
aagaagctcatggaggctcatggtgtgaatagattgagcttggttggtataagctatggagggtttgtagggtatagtttggctgctcagtttcctgagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1674371 |
aagaagctcatggaggctcatggtgtgaatagattgagcttggttggtataagctatggagggtttgtagggtatagtttggctgctcagtttcctgagg |
1674470 |
T |
 |
| Q |
201 |
tggtggagaagttggctttgtgttgtgctggtgtttgtttggaggagattgatatgaaaaatggtttgtttagggtttcttctttagaggaagcttgtag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1674471 |
tggtggagaagttggctttgtgttgtgctggtgtttgtttggaggagattgatatgaaaaatggtttgtttagggtttcttctttagaggaagcttgtag |
1674570 |
T |
 |
| Q |
301 |
tattttgttgccacaaactcctgataggcttagggaattgatgaggttgtcttttgttaggcctgctagggctgtgccttcttggttccttgaagatttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1674571 |
tattttgttgccacaaactcctgataggcttagggaattgatgaggttgtcttttgttaggcctgctagggctgtgccttcttggttccttgaagatttc |
1674670 |
T |
 |
| Q |
401 |
attcgtgt |
408 |
Q |
| |
|
|||||||| |
|
|
| T |
1674671 |
attcgtgt |
1674678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University