View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6111_high_3 (Length: 331)
Name: NF6111_high_3
Description: NF6111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6111_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 305
Target Start/End: Complemental strand, 52472223 - 52471937
Alignment:
| Q |
19 |
ctctcagcataaaggaaaatagagacatatcaaaacataggcaacaatcgacgggtgagactgcctccttctataccttgctgaatggtgttactaagaa |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472223 |
ctctaagcataaaggaaaatagagacatatcaaaacataggcaacaatcgacggatgagactgcctccttctataccttgctgaatggtgttactaagaa |
52472124 |
T |
|
| Q |
119 |
ggatggggttttaaattggctaacaaaagaagggtgagtttctgtctaaacagcagcaagcagacatgacagttactatacggtgttaaaagagatcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472123 |
ggatggggttttaaattggctaacaaaagaagggtgagtttctgtctaaacagcagcaagcagacatgacagttactatacggtgttaaaagagatcaca |
52472024 |
T |
|
| Q |
219 |
aaacacgtctcactgtaccaccacactcagcctatattctctcccaatgttgggcttccaagggcctcaatccaacacttggaccat |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472023 |
aaacacgtctcactgtaccaccacactcagcctatattctctcccaatgttgggcttccaagggcctcaatccaacacttggaccat |
52471937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University