View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6111_low_4 (Length: 308)
Name: NF6111_low_4
Description: NF6111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6111_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 21 - 211
Target Start/End: Complemental strand, 31844599 - 31844406
Alignment:
| Q |
21 |
gtagcttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttcatagaagggatagagcaaggcttagacaatcatcaccacc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31844599 |
gtagcttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttcatagaagggatagagcaaggcttagacaatcatcaccacc |
31844500 |
T |
 |
| Q |
121 |
aacaactcatgaaccagctcaa---attcaaggttcttctatgcttaatcttaaccttaataaccctactatcactactactaaccctaattta |
211 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31844499 |
aacaactcatgaaccagctcaacttaatgaaggttcttctatgcttaatcttaaccttaataaccctactatcactactactaaccctaattta |
31844406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 6889899 - 6889821
Alignment:
| Q |
21 |
gtagcttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttcatagaagggatagagcaag |
99 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||| | || || || |||||||||||||||| ||||||||||| |
|
|
| T |
6889899 |
gtagcttttgtagaagagagtttaggtcagcacaagcattaggtggacatatgaatgttcatagaaaagatagagcaag |
6889821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 102
Target Start/End: Original strand, 34522611 - 34522688
Alignment:
| Q |
25 |
cttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttcatagaagggatagagcaaggct |
102 |
Q |
| |
|
|||||||| || |||||||| || |||||||| ||||| |||||||||||| ||||||| || |||||||| ||||| |
|
|
| T |
34522611 |
cttttgtaaaagagagtttaggtctgctcaagctcttggtggtcacatgaatattcataggagagatagagctaggct |
34522688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University