View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_high_1 (Length: 420)
Name: NF6113_high_1
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 1 - 404
Target Start/End: Complemental strand, 4069465 - 4069063
Alignment:
| Q |
1 |
tataactatacataatttcaaatctgatcaaaacttggcttggcagattttatgtggacaatatccccattagggtatacaagaacaatagcaacattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4069465 |
tataactatacataatttcaaatctgatcaaaacttggcttg-cagattttatgtggacaatatccccattagggtatacaaggacaatagcaacattgg |
4069367 |
T |
 |
| Q |
101 |
agtgggatacccatcaaaggcaatgcaagtacaagcaagtttatggaatggtgaaaattgggcaacagatggagggaaagccaaaataaattggacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4069366 |
agtgggatacccatcaaaggcaatgcaagtacaagcaagtttgtggaatggtgaaaattgggcaacagatggagggaaagccaaaataaattggacaaat |
4069267 |
T |
 |
| Q |
201 |
gcacctttcaaagcaaacttccaaggatttgatgtcagtggatgtcaaagtcaaaccttaattcatccaaattgtgcttctaataactattggtggaatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4069266 |
gcacctttcaaagcaaacttccaaggatttgatgtcagtggatgtcaaagtcaaaccttaattgatccaaattgtgcttctaataactattggtggaatg |
4069167 |
T |
 |
| Q |
301 |
acaaaaagttttggcaattggatcctgccggacaaagacaatatgaaaatgtaaagcaaaattatgtgacatatgattattgtaaagataggcataggtt |
400 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4069166 |
aacaaaagttttggcaattggatcctgccggacaaagacaatatgaaaatgtaaagcaaaattatgtgacatatgattattgtaaagataggcataggtt |
4069067 |
T |
 |
| Q |
401 |
tcct |
404 |
Q |
| |
|
|||| |
|
|
| T |
4069066 |
tcct |
4069063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University