View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_high_17 (Length: 211)
Name: NF6113_high_17
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 85 - 197
Target Start/End: Original strand, 34534068 - 34534180
Alignment:
| Q |
85 |
ttgtactcttgaagatgaggtcacaatttcctcatccaaggatctatttggttctgaaattggttttgaagcttcattttctgctgatccaggcttagat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34534068 |
ttgtactcttgaagatgaggtcacaatttcctcatccaaggatctatttggttctgaaattggttttgaagcttcattttctgctgatccaggcttagat |
34534167 |
T |
 |
| Q |
185 |
cctccccgatttt |
197 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34534168 |
cctccccgatttt |
34534180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 34533963 - 34534039
Alignment:
| Q |
13 |
agcaaaggaatcgtaatcaggtaactttggatgaacgtgatctgctttctgcttagatggagggtcactgtcttgta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533963 |
agcaaaggaatcgtaatcaggtaactttggatgaacgtgatctgctttctgcttagatggagggtcactgtcttgta |
34534039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University