View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_high_5 (Length: 313)
Name: NF6113_high_5
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 32 - 221
Target Start/End: Original strand, 26185232 - 26185422
Alignment:
| Q |
32 |
aataaggacgtgtatgcttcaatgggaccaatttaaattata-cttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185232 |
aataaggacgtgtatgcttcaatgggaccaatttaaattataacttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactat |
26185331 |
T |
 |
| Q |
131 |
gttacgttgttatattactttatagtaaattatttcaacaaacatctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185332 |
gttacgttgttatattactttatagtaaattatttcaacaaacatctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt |
26185422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 246 - 302
Target Start/End: Original strand, 26185415 - 26185471
Alignment:
| Q |
246 |
ttagccttgcattttttatctttttatttcatatcatgttctaatttggatacctat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26185415 |
ttagccttgcattttttatctttttatttcatatcatgttttaatttggatacctat |
26185471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 26185171 - 26185202
Alignment:
| Q |
1 |
tggactataccttatgctaaaatcgaccctga |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26185171 |
tggactataccttatgctaaaatcgaccctga |
26185202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University