View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_high_8 (Length: 251)
Name: NF6113_high_8
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_high_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 5129731 - 5129500
Alignment:
| Q |
12 |
atgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatctctgttcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
5129731 |
atgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatctctgttcat |
5129633 |
T |
|
| Q |
112 |
tagtcattatctatggttttcggagaatgacttgctaccttgttaccttcattaggaaaaacaagacagttctttatcattcagtttcctgatgtcttat |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| || | | || | |||| |||||||||||||||||||||||||||| |
|
|
| T |
5129632 |
tagtcattatctatggttttcagagaatgacttgctaccttgttgcc--gagtgcttaatgc---tcagt--tttatcattcagtttcctgatgtcttat |
5129540 |
T |
|
| Q |
212 |
atatgcttttcttcatctatcttgtcttcttagtctttat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129539 |
atatgcttttcttcatctatcttgtcttcttagtctttat |
5129500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University