View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_low_15 (Length: 228)
Name: NF6113_low_15
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 7 - 130
Target Start/End: Original strand, 15789437 - 15789560
Alignment:
| Q |
7 |
atagtaaccaagcatcttgcacaaacaaggaatcaaaataattatacgtgctcattaaccaaatttgttatataccctaaaaagatttttaagaaatatt |
106 |
Q |
| |
|
||||||||||| |||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15789437 |
atagtaaccaaacatcttacacaaacaagaaatcaaagtaattatacgtgctcattaaccaaatttgttatataccctataaagatttttaagaaatatt |
15789536 |
T |
 |
| Q |
107 |
tgaataagtagtacccaacatatg |
130 |
Q |
| |
|
|||| |||||||| |||||||||| |
|
|
| T |
15789537 |
tgaacaagtagtatccaacatatg |
15789560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 137 - 228
Target Start/End: Original strand, 15789967 - 15790058
Alignment:
| Q |
137 |
aacatattgtgacttggaatggatcgttggatcaacaacttataacaaatggatggagtgagttttgtgaatttacaacttataataccagc |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15789967 |
aacatattgtgatttggaatggatcgttggatcaacaacttataacaaatggatggagtgagatttgtgaatttacaacttataataccagc |
15790058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University