View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_low_16 (Length: 221)
Name: NF6113_low_16
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 205
Target Start/End: Original strand, 35206128 - 35206312
Alignment:
| Q |
21 |
gaatctcataagctgctttatttttctgttcctctgttccgaaaactagtctccgagctaatgaccatgacgtgaattgtatcgcatgtgctgcagctgg |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35206128 |
gaatctcataagctgctttgtttttctgttcctctgttccgaaaactagtctccgggctaatgaccatgacgtgaattgtattgcatgtgctgcagctgg |
35206227 |
T |
 |
| Q |
121 |
actaccgggattaaccgtggctgcaggcttgctgatgtggagcttggatgttgaaactgaaattttgttatcataacagaactgt |
205 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206228 |
actaccgggattaaccgtggatgcaggtttgctgatgtggagcttggatgttgaaactgaaattttgttatcataacagaactgt |
35206312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 63
Target Start/End: Original strand, 43985827 - 43985869
Alignment:
| Q |
21 |
gaatctcataagctgctttatttttctgttcctctgttccgaa |
63 |
Q |
| |
|
||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
43985827 |
gaatctcgtaagctgctttattcttctgttgctctgttccgaa |
43985869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University