View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_low_17 (Length: 218)
Name: NF6113_low_17
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 15790520 - 15790658
Alignment:
| Q |
1 |
cctattaacc-ttttatttatatatagtataa----ataacattgcatacaagtttgcaaatattataaagtcttgagttgatcatacattttcaaatga |
95 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15790520 |
cctattaacccttttatttatatatagtataattaaataacattgcatacaggtttgcaaatattataaagtcttgagttgatcatacattttcaaatga |
15790619 |
T |
 |
| Q |
96 |
ctttccttactttgagattattgaagagagcatgttgct |
134 |
Q |
| |
|
|||||||||||||| ||||| |||||| | ||||||||| |
|
|
| T |
15790620 |
ctttccttactttgtgattaatgaagaaatcatgttgct |
15790658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 97 - 212
Target Start/End: Original strand, 15790734 - 15790849
Alignment:
| Q |
97 |
tttccttactttgagattattgaagagagcatgttgcttattaatttacgaatattatcagtttaaannnnnnnnnngatcgaatatcgaacgaagccat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
15790734 |
tttccttactttgagattattgaagagagcatgttgcttattaatttacgaatattatcagtttaaatattttttctgatcgaataccgaacgaaaccat |
15790833 |
T |
 |
| Q |
197 |
tactctcctaccctat |
212 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
15790834 |
tactcacctaccctat |
15790849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University