View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6113_low_5 (Length: 324)
Name: NF6113_low_5
Description: NF6113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6113_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 15 - 324
Target Start/End: Complemental strand, 35463383 - 35463074
Alignment:
| Q |
15 |
tcaaccattgttctaaactgtggttcgcaaccgcagcttaaaaccatgatttaacagtgtatcaataatagaagtagggaaaaaggacgaagttaacact |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35463383 |
tcaaccattgttctaaactgtggttcgaaaccgcagcttaaaaccatgatttaacaatgtatcaataatagaagtagggaaaaaggacgaagttaacact |
35463284 |
T |
|
| Q |
115 |
taactttcttcgatttggaccaccttctcttctctaaatgagtctagcctcgtagattgtttttgccttatgcctgagtcattagttctatctcgagagc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35463283 |
taactttcttcgatttggaccaccttctcgtctctaaatgagtctagcctcgtagattgtttttgccttatgcctgagtcattagttctatctcgagagc |
35463184 |
T |
|
| Q |
215 |
ttcttgatccatcagaaataggagatctactgaattcacttggtggcgatttggtcgttgaagaagtcataaccgaccgtgaattgcattttgagtttcc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35463183 |
ttcttgatccatcagaaataggagatctactgaattcacttggtggcgatttggtcgttgaagaagtcataaccgaccgtgaattgcattttgagtttcc |
35463084 |
T |
|
| Q |
315 |
cgaggatgat |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
35463083 |
cgaggatgat |
35463074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University