View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6114_low_10 (Length: 201)
Name: NF6114_low_10
Description: NF6114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6114_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 185
Target Start/End: Complemental strand, 37768261 - 37768089
Alignment:
| Q |
13 |
gcataggctaagatcagtgaagtatatccatgccctcaatcaagcatagctttgatgtctgtaataggaacaatacaatgtgttattttcggttttattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768261 |
gcataggctaagatcagtgaagtatatccatgccctcaatcaagcatagctttgatgtctgtaataggaacaatacaatgtgttattttcggttttattg |
37768162 |
T |
|
| Q |
113 |
ttgagagggatttgaaccaatggaaacttggttggaatatcaggctcctcaccgttgttttttcggtatgctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768161 |
ttgagagggatttgaaccaatggaaacttggttgggatatcaggctcctcaccgttgttttttcggtatgctt |
37768089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University