View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6114_low_4 (Length: 267)
Name: NF6114_low_4
Description: NF6114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6114_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 38626324 - 38626070
Alignment:
| Q |
1 |
cccatatgtacatttcgtagattcttatgtagatgatgagcctcatgatccgtttgagtctcgcaccacactgcnnnnnnncagaggggggacacaccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38626324 |
cccatatgtacatttcgtagattcttatgtagatgatgagcctcatgatccgtttgagtctcgcaccacactgctttttttcagaggggggacacaccgt |
38626225 |
T |
|
| Q |
101 |
aaggatgtatgtatttatgttgatgagatttaattgaaggaataatgctgacctccttatacttacaggcaacttgatttttggggtgtgtcatgtttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626224 |
aaggatgtatgtatttatgttgatgagatttaattgaaggaataatgctgacttccttatacttacaggcaacttgatttttggggtgtgtcatgtttgc |
38626125 |
T |
|
| Q |
201 |
agaaaggcattgttcgtgctaaattcacaaagatattagctggttttgatgatgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626124 |
agaaaggcattgttcgtgctaaattcacaaagatattagctggttttgatgatgt |
38626070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University