View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6116_low_1 (Length: 399)
Name: NF6116_low_1
Description: NF6116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6116_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 241 - 381
Target Start/End: Complemental strand, 2937976 - 2937836
Alignment:
| Q |
241 |
tatccctgaaattgaccagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaa |
340 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937976 |
tatcccttaaattgaccagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaa |
2937877 |
T |
|
| Q |
341 |
ccaggccagagtcatttggttgcaaaaattctttatgtttc |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937876 |
ccaggccagagtcatttggttgcaaaaattctttatgtttc |
2937836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 149 - 241
Target Start/End: Complemental strand, 2938314 - 2938222
Alignment:
| Q |
149 |
aggtcaccctctcctcgtggactttattccaacaacaaagcatctcattttcctggagggaatgctggttacagtcaaacttataatgccgtt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2938314 |
aggtcaccctctcctcgtggactttattccaacaacgaagcatctcattttcctggagggaatgctggttacagtcaaacttataatgccgtt |
2938222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 2939037 - 2938998
Alignment:
| Q |
19 |
acgaatgtgtacaaaactgcacgcaagtgtaagctaaggc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939037 |
acgaatgtgtacaaaactgcacgcaagtgtaagctaaggc |
2938998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University