View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6118_high_29 (Length: 224)
Name: NF6118_high_29
Description: NF6118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6118_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 299286 - 299475
Alignment:
| Q |
18 |
aatttaggtacatgtacaaatgttttagatggattactaactggtttcccctttcctttcaacagcttcagatttttctgtggggcaatttcagtttttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
299286 |
aatttaggtacatgtacaaatgttttagatggattactaactggtttcccctttcctttcaacagcttcagatttttctgtggcgcaatttcagtttttg |
299385 |
T |
 |
| Q |
118 |
nnnnnnntcacttttggttcatgggcacttgaattatcagtatgttgtttatttagttttgtataatttagcttctaacacaatgctgtct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
299386 |
-aaaaaatcacttttggttcatgggcacttgaattatcagtatgttgtttatttagttttgtataatttagcttctaacacaatgctgtct |
299475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University