View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6118_high_32 (Length: 202)
Name: NF6118_high_32
Description: NF6118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6118_high_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 11903474 - 11903675
Alignment:
| Q |
1 |
attttctcaaaatttcttttgaccttcttcatgttactattaactgtttctgttgctgcttctgctgcttcttgagatattgacaaacacaatcccttta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11903474 |
attttctcaaaatttcttttgacattcttcatgttactattaactgtttctgttgctgcttctgctgcttcttgagatattgacaaacacaatcccttta |
11903573 |
T |
|
| Q |
101 |
aatccacctcggtcaagcgtttgaactcctccgcggctttcttgactttgaaatgattggttatttttaggccgaatgcaatgaacgctgttgttgagcc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11903574 |
aatccacctcgatcaagcgtttgaactcctccgcggctttcttgactttgaaatgattggttatttttaggccgaatgcaatgaacgctgttgttgagcc |
11903673 |
T |
|
| Q |
201 |
ac |
202 |
Q |
| |
|
|| |
|
|
| T |
11903674 |
ac |
11903675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University