View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6118_low_10 (Length: 366)
Name: NF6118_low_10
Description: NF6118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6118_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 16 - 163
Target Start/End: Original strand, 31971659 - 31971806
Alignment:
| Q |
16 |
atggacactaaagattgatctggctgcctagctttgatccaaagtcaactttttggacctatacttcaggtggcagttatcaattgtgtaaattgtgtct |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31971659 |
atggacactaaagattgatctgattgcctagctttgatccaaagtcaactttttggacctatacttctggtggcagttatcaattgtgtaaattgtgtct |
31971758 |
T |
|
| Q |
116 |
ggtcttgtttagattggttttggttcttttgaatcatgaaaacatgtg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31971759 |
ggtcttgtttagattggttttggttcttttgaatcatgaaaacatgtg |
31971806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 234 - 348
Target Start/End: Original strand, 31971883 - 31971997
Alignment:
| Q |
234 |
tactctcttagaaagttatagtaaagatacaaaagtggaacttcgcttataaacttaagaagatcgatgacatccggaggagaaacatgaataagaaagt |
333 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
31971883 |
tactctcttggaaagttatagtaaagatacaaaagtggaacttcgcttataaacttcagaagatcgatgacatccgaaagagaagcatgaataagaaagt |
31971982 |
T |
|
| Q |
334 |
ttgtagtcgcggaag |
348 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31971983 |
ttgtagtcgcggaag |
31971997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University