View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6118_low_14 (Length: 325)

Name: NF6118_low_14
Description: NF6118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6118_low_14
NF6118_low_14
[»] chr6 (1 HSPs)
chr6 (243-312)||(15450031-15450100)


Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 243 - 312
Target Start/End: Original strand, 15450031 - 15450100
Alignment:
243 attctcgtgttctaaggattgtgggataagtgcgacaattatgagtcaccgaagcctccccgatgatgtc 312  Q
    |||||||||||||||||||||||||||| ||||||||  ||||||||| |||||||||||| ||||||||    
15450031 attctcgtgttctaaggattgtgggataggtgcgacagctatgagtcaacgaagcctcccccatgatgtc 15450100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University