View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6118_low_23 (Length: 245)
Name: NF6118_low_23
Description: NF6118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6118_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 52792864 - 52793054
Alignment:
| Q |
18 |
cattctgcagcatctaacagggtataaatggaatttccttatgccaccgccgcgtcggatgagtgagtttggatacaacgacaacagacgagggaaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52792864 |
cattctgcagcatctaacagggtataaatggaatttccttatgccaccgccgcgtcggatgagtgagtttggatacaacgacaacagacgagggaaacaa |
52792963 |
T |
|
| Q |
118 |
a---tactagtagttaatagtaccatcatctttctcttctttttaatcaaatcttcgctcgggtgggtgggttggtcaacacaaacacgta |
205 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52792964 |
atactactagtagttaatagtaccatcatctttctcttctttttaatcaaatcttcgctcgggtgggtgggtgggtcaacacaaacacgta |
52793054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University