View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_high_16 (Length: 293)
Name: NF6120_high_16
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 156 - 275
Target Start/End: Complemental strand, 24887478 - 24887363
Alignment:
| Q |
156 |
gtgagattcagatgcagtgaaagtaataaacatacatacgtaccaatattcttcaaaaaacatacgtaccaatacaagtttgtaaggcttgagaatttcc |
255 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24887478 |
gtgagattcagatgcagtaaaagtaataaacatac----gtaccaatattcttcaaaaaacatacttaccaatacttgtttgtaaggcttgagaatttcc |
24887383 |
T |
 |
| Q |
256 |
tcttccctgaagctcgttgt |
275 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24887382 |
tcttccctgaagctcgttgt |
24887363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 24887563 - 24887507
Alignment:
| Q |
65 |
tttttccagattgttacctccactatataggtaccgatctaatattgaatatatata |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24887563 |
tttttccagattgttacctccactatataggtaccgatctaatattgaatatatata |
24887507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University