View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_high_17 (Length: 292)
Name: NF6120_high_17
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 277
Target Start/End: Complemental strand, 34661455 - 34661202
Alignment:
| Q |
20 |
aactaattgggagtgcattgatatatatatgcagctaatgaggtatgtgatagatttgcggtgactggttttaatggtaacttgataagttacctaactc |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34661455 |
aactaattgggagtgcattgatatat----gcagctaatgaggtatgtgatagatttgcggtgactggttttaatggtaacttgataagttacctaactc |
34661360 |
T |
 |
| Q |
120 |
aagagttgaatatgccattggtatcagctgcaaacacactcacaatctttggtggaacagctagcttcacacctctcattggtgctctcatttcagagtc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34661359 |
aagagttgaatatgccattggtatcagctgcaaacacactcacaatctttggtggaacagctagcttcacacctctcattggtgctctcatttcagagtc |
34661260 |
T |
 |
| Q |
220 |
ctttgctggtcacttctggaccattaccattgcttccatcatttatgaactggttcat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34661259 |
ctttgctggtcacttctggaccattaccattgcttccatcatttatgaactggttcat |
34661202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 48 - 201
Target Start/End: Complemental strand, 34647266 - 34647113
Alignment:
| Q |
48 |
atgcagctaatgaggtatgtgatagatttgcggtgactggttttaatggtaacttgataagttacctaactcaagagttgaatatgccattggtatcagc |
147 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| |||| ||| | |||||||||||||||||||||| |||||||||||||||||||||||| | || |
|
|
| T |
34647266 |
atgcagcaaatgaagtatgtgatagatttgcgggcgctggatttcacagtaacttgataagttacctaacccaagagttgaatatgccattggtagctgc |
34647167 |
T |
 |
| Q |
148 |
tgcaaacacactcacaatctttggtggaacagctagcttcacacctctcattgg |
201 |
Q |
| |
|
| |||| |||||||||| ||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
34647166 |
ttcaaatacactcacaaactttggtggaacatctagcttcacccctcttattgg |
34647113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University