View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_high_22 (Length: 251)
Name: NF6120_high_22
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_high_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 29247875 - 29248112
Alignment:
| Q |
14 |
tactcttcactctttaactggccattttacttcacaactatttgatcctggtgctgcaattatgaattttgaagacacaaatgtttgccctttaaacata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29247875 |
tactcttcactctttaactggccattttacttcacaactatttgatcctggtgctgcaattatgaattttgaagacacaaatgtttgccctttaaccata |
29247974 |
T |
 |
| Q |
114 |
gataataagttgagtgcggaaagaaaggatatcttggatccttttgggggcgatgcctcatttggtttatcaatgtcaactacactagtagattctcaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29247975 |
gataataagttgagtgcggaaagaaaggatatcttggatccttttgggggcgatgcctcatttggtttatcaatgtcaactacactagaagattctcaac |
29248074 |
T |
 |
| Q |
214 |
cagtttttaatcacaacgggattagaaaagtcaaagtt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29248075 |
cagtttttaatcacaatgggattagaaaagtcaaagtt |
29248112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University