View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_high_26 (Length: 241)
Name: NF6120_high_26
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 36689836 - 36690010
Alignment:
| Q |
18 |
acttagcccatgatttcttaaccaagtttcgaaaggtatgtgtggagtctgctgtagtggattcaacatttggtgacaccattttgaaaaattggtctta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36689836 |
acttagcccatgatttcttaaccaagtttcgaaaggtatatgtggagtctgctgtagtggattcaacatttggtgacaccattttgaaaaattggtctta |
36689935 |
T |
 |
| Q |
118 |
attcaagggaactaaagtgcttgaagtgcacacnnnnnnnnnttgcaagattggaaagatatctttagcttactatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
36689936 |
attcaagggaactaaagtgcttgaagtgcaca--aaaaaaaattgcaagattggaaaggtatctttagcttactatg |
36690010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 227
Target Start/End: Original strand, 36690023 - 36690069
Alignment:
| Q |
181 |
tttagcttactatgaacttagtgatattgtcttgagctaaggacaca |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36690023 |
tttagcttactatgaacttagtgatattgtcatgagctaaggacaca |
36690069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University