View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_high_33 (Length: 210)
Name: NF6120_high_33
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 73 - 200
Target Start/End: Complemental strand, 39328557 - 39328430
Alignment:
| Q |
73 |
aaagaatgtttgatgatatttgttgatgagttagatcatttaaaagatctcaagccgcagtatgagcttagtgttgtttgtcgatgatgttattgataaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39328557 |
aaagaatgtttgatgatatttgttgatgagttagatcatttaaaagatctcaagccgcagtatgagcctagtgttgtttgtcgatgatgttattgataaa |
39328458 |
T |
|
| Q |
173 |
tgttttagtatgtcgtgtatattgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39328457 |
tgttttagtatgtcgtgtatattgatga |
39328430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University