View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_low_14 (Length: 312)
Name: NF6120_low_14
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 14 - 312
Target Start/End: Complemental strand, 29248399 - 29248101
Alignment:
| Q |
14 |
gatattgcattacaaatatctgtgtatgttgaaggtattgataacttgccatctcccttgttataagattgactcatcgacactaaattgttctctgtcc |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29248399 |
gatattgcagtacaaatatctgtgtatgttgaaggtattgataacttgccatctcccttgttataagattgactcatcgacactaaattgttctctgtcc |
29248300 |
T |
|
| Q |
114 |
tgtcaaaagcgccacccgtcaatattacattggcatcccctttgttgtatgagagacatgttgatattgaataatcaccttccttgaatgcatgagtatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29248299 |
tgtcaaaagcgccacccgtcaatattacattggcatcccctttgttgtatgagagacatgttgatattgaataatcaccttccttgaatgcatgagtatt |
29248200 |
T |
|
| Q |
214 |
tgacacaatgttgctaacccctccatcatagggattattacttggaacagacatgaaattctcagactctttctccttcacctcattaactttgacttt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29248199 |
tgacacaatgttgctaacccctccatcatagggattattgcttggaacagacatgaaattctcagactccttctccttcacctcattaactttgacttt |
29248101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University