View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6120_low_33 (Length: 218)
Name: NF6120_low_33
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6120_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 13316225 - 13316426
Alignment:
| Q |
1 |
acaaaaattataaaatttatgttattcttagaataaattt-cattctaattgannnnnnn-agaaataagaggaattagtgtaatgtgatgtgttatttg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13316225 |
acaaaaattataaaatttatgttattcttagaataaattttcattctaattgattttttttagaaataagaggaattagtgtaatgtgatgtgttatttg |
13316324 |
T |
 |
| Q |
99 |
attttaagttatattg-nnnnnnnncttttatttnnnnnnntgaccaaaataaatcgtattggtgacacatttgtacatttatcaaaagatattgcagta |
197 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13316325 |
attttaagttatattgtttttttttcttttatttaaaaaaatgaccaaaataaatcgtatcggtgacacatttgtacatttatcaaatgatattgcagta |
13316424 |
T |
 |
| Q |
198 |
ag |
199 |
Q |
| |
|
|| |
|
|
| T |
13316425 |
ag |
13316426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University