View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6120_low_35 (Length: 210)

Name: NF6120_low_35
Description: NF6120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6120_low_35
NF6120_low_35
[»] chr5 (1 HSPs)
chr5 (73-200)||(39328430-39328557)


Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 73 - 200
Target Start/End: Complemental strand, 39328557 - 39328430
Alignment:
73 aaagaatgtttgatgatatttgttgatgagttagatcatttaaaagatctcaagccgcagtatgagcttagtgttgtttgtcgatgatgttattgataaa 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
39328557 aaagaatgtttgatgatatttgttgatgagttagatcatttaaaagatctcaagccgcagtatgagcctagtgttgtttgtcgatgatgttattgataaa 39328458  T
173 tgttttagtatgtcgtgtatattgatga 200  Q
    ||||||||||||||||||||||||||||    
39328457 tgttttagtatgtcgtgtatattgatga 39328430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University