View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6122_low_2 (Length: 294)
Name: NF6122_low_2
Description: NF6122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6122_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 282
Target Start/End: Complemental strand, 8683688 - 8683420
Alignment:
| Q |
14 |
gaacctgtgaatgaatcaatgaacatataagataacaaatcaaagatttacataaaaatcgaaacaaaagacgttacagatactaacctgacagcatttc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8683688 |
gaacctgtgaatgaatcaatgaacatataagataacaaatcaaagatttacataaaaatcgaaacaaaagaagttacagatactaacctgacagcatttc |
8683589 |
T |
 |
| Q |
114 |
tccnnnnnnnnnnnnntccaatagccatttggaaacttgaacttatgatcaaagcaccttgaatccctctcattgtcatagtaaacctctaggaaattca |
213 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683588 |
tccaaaaaccaaaaaatccaatagccatttggaaacttgaacttatgatcaaagcaccttgaatccctctcattgtcatagtaaacctctaggaaattca |
8683489 |
T |
 |
| Q |
214 |
aacaaacatgtagacaaagtcagcaaaatgaaaacgctaaagagtgaaacattttccatttataacatg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683488 |
aacaaacatgtagacaaagtcagcaaaatgaaaacgctaaagagtgaaacattttccatttataacatg |
8683420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University