View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6123_low_2 (Length: 375)
Name: NF6123_low_2
Description: NF6123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6123_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 11 - 375
Target Start/End: Original strand, 32296634 - 32296998
Alignment:
| Q |
11 |
agcagagagagatatataaggaaagagaaaaaatacgaagcaacgaacagaagtaaagttagcaacaacaatccaaacagtttggacccaaccggaatta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32296634 |
agcagagagagatatataaggaaagagaaaaaatacgaagcaacgaacagaagtaaagttagcaacaacaatccaaacagtttggacccaaccggaatta |
32296733 |
T |
 |
| Q |
111 |
gcgctcttcttcaccaccattcacatttcctttctcaatcttcaatctcactcaccaaaaccctaattctcccaattccttcgatccgattcgttttgtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32296734 |
gcgctcttcttcaccaccattcacatttcctttctcaatcttcaatctcactcaccaaaaccctaattctcccaattccttcgatccgattcgttttgtg |
32296833 |
T |
 |
| Q |
211 |
ttttcattcaatcaattccgccggcgatctgaatcctaatcgatcgacattgctcaattctgttccgaattcattgcgattcactcgctgaatctcgtaa |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32296834 |
ttttcattcaatcaattccgccggcgatctgaatcctaatcgatcgacattgctcaattctgttccgaattcattgcgattcactcgctgaatctcgaaa |
32296933 |
T |
 |
| Q |
311 |
cgcttagattcatgctattacgataggttatggttggaaaaccaaggttaacggtgtttacattt |
375 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32296934 |
cgcttagattcatggtattacgataggttatggttggaaaaccaaggttaacggtgtttacattt |
32296998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University