View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6124_high_12 (Length: 320)
Name: NF6124_high_12
Description: NF6124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6124_high_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 118 - 320
Target Start/End: Original strand, 8930508 - 8930710
Alignment:
| Q |
118 |
atcacacattattgagaaattgaaactaaggataatttaaattttatcaacaaccacttacactacccaatctaacaagacatatattttacaaagcaac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8930508 |
atcacacattattgagaaattgaaactaaggataatttaaattttataaacaaccacttacactacccaatctaacaagacatatattttacaaagcaac |
8930607 |
T |
 |
| Q |
218 |
aaattcctactcacatgattgtacaagcatttggattatcatcactaaatgcagtagtgtacttaacctcgaacagacttgaacgtgaaagagtcgaagc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
8930608 |
aaattcctactcacatgattgtacaagcatttggattatcatcactaaatgcagtagtgtacttaacctcgaacggacttgaacgtgcaagagtcgaagc |
8930707 |
T |
 |
| Q |
318 |
ttc |
320 |
Q |
| |
|
||| |
|
|
| T |
8930708 |
ttc |
8930710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 121
Target Start/End: Complemental strand, 31917437 - 31917405
Alignment:
| Q |
89 |
gaaaacaaacataaagaagattattccttatca |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
31917437 |
gaaaacaaacataaagaagattattcattatca |
31917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 121
Target Start/End: Original strand, 50376391 - 50376423
Alignment:
| Q |
89 |
gaaaacaaacataaagaagattattccttatca |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
50376391 |
gaaaacaaacataaagaagattattcattatca |
50376423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University