View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6124_high_28 (Length: 235)
Name: NF6124_high_28
Description: NF6124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6124_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 53147647 - 53147436
Alignment:
| Q |
1 |
gatcttgggaaacatgatgatgattgaaaggcatgtaggggggaccaccttatcttttatagtagtgcataattaaataaaattatttataaaataggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147647 |
gatcttgggaaacatgatgatgattgaaaggcatgtaggggggaccaccttatcttttatagtagtgcataattaaataaaattatttataaaataggat |
53147548 |
T |
 |
| Q |
101 |
tattttctaaacaatgcttttaaataaaacataccgacatatatannnnnnnnataattgcttgtagtcacagaaatgggatcctatgattacaaccacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147547 |
tattttctaaacaatgcttttaaataaaacataccgacatatatatattttttataattgcttgtagtcacagaaatgggatcctatgattacaaccacc |
53147448 |
T |
 |
| Q |
201 |
ggcagttccacc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53147447 |
ggcagttccacc |
53147436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University