View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6124_high_29 (Length: 227)
Name: NF6124_high_29
Description: NF6124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6124_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 87 - 209
Target Start/End: Complemental strand, 30032542 - 30032420
Alignment:
| Q |
87 |
atgttagtggttaatttgttggtagaagattcagtgaattggaaaaaggaggcaggaaatagaagtgtgaacaaactactattttctgcaatacgcaatt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032542 |
atgttagtggttaatttgttggtagaagattcagtgaattggaaaaaggaggtaggaaatagaagtgtgaacaaactactattttctgcaatacgcaatt |
30032443 |
T |
 |
| Q |
187 |
gacgtgtttctatagcttcaaat |
209 |
Q |
| |
|
|||||||||| ||||| |||||| |
|
|
| T |
30032442 |
gacgtgtttcgatagcctcaaat |
30032420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University