View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6124_high_29 (Length: 227)

Name: NF6124_high_29
Description: NF6124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6124_high_29
NF6124_high_29
[»] chr1 (1 HSPs)
chr1 (87-209)||(30032420-30032542)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 87 - 209
Target Start/End: Complemental strand, 30032542 - 30032420
Alignment:
87 atgttagtggttaatttgttggtagaagattcagtgaattggaaaaaggaggcaggaaatagaagtgtgaacaaactactattttctgcaatacgcaatt 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
30032542 atgttagtggttaatttgttggtagaagattcagtgaattggaaaaaggaggtaggaaatagaagtgtgaacaaactactattttctgcaatacgcaatt 30032443  T
187 gacgtgtttctatagcttcaaat 209  Q
    |||||||||| ||||| ||||||    
30032442 gacgtgtttcgatagcctcaaat 30032420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University