View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6124_high_6 (Length: 423)
Name: NF6124_high_6
Description: NF6124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6124_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 9 - 405
Target Start/End: Original strand, 29144905 - 29145296
Alignment:
| Q |
9 |
agcacagaggaaaatgtcactaacagttactcttctaagacaattgattccattctgaaaaggagattggttaagccaaattctgactcaattactccac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29144905 |
agcacagaggaaaatgtcactaacagttactcttctaagacgattgattccattctgaaaaggagattggttaagccaaattctgactcaattactccac |
29145004 |
T |
|
| Q |
109 |
atggttcaactagatctttgctcagcgacacaacttttttagatggctcttcagattatgattctagcttggtattaactaaggttgatgataaaaagga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145005 |
atggttcaactagatctttgctcagcgacacaacttttttagatggctcttcagattatgattctagcttggtattaactaaggttgatgataaaaagga |
29145104 |
T |
|
| Q |
209 |
tcaagttgttggtcaaaatgaagccaaccctgcatcgaaatcgagttcctcaagccaggttagttttcttttctcgtagcatcgacactttaaattgaag |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29145105 |
tcaagttgttggtcaaaatgaagccaaccctgcatcgaaatcgggctcctcaagccaggttagttttcttttctcgtagcatcaacactttaaattgaag |
29145204 |
T |
|
| Q |
309 |
gtgtgtctagtatatatccaacacatgtcggacacatttgacactcgtggttacattctctcaaattattactggtgtcaatgagaagtggcaatgt |
405 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29145205 |
gtgtgtctag----tatccaacacatgtcggacacatttgacactcgtggttacattctctcaaattattact-gtgtcaatgagaagtggcaatgt |
29145296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University