View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6124_low_19 (Length: 255)
Name: NF6124_low_19
Description: NF6124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6124_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 45390185 - 45389956
Alignment:
| Q |
19 |
caaacgacactccttgaacctgaagagggtttataatattacatttcgtataattaatcagccagacaacagaaaatgacatcaagatggaaaaatgaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45390185 |
caaacgacactccttgaacctgaagagggtttataatattacatttcatataattaatcagccagacaacagaaaatgacatcaagatggaaaaatgaca |
45390086 |
T |
|
| Q |
119 |
tttaagatgaatttatttactgtcactctgggctgttgataatgagtagccatcagtactgcatttatcctaatccagtgaacactttattcctcttcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45390085 |
tttaagatgaatttatttactgtcactctgggctgttgataaagagtagccatcagtgctgcatttatcctaatccggtgaacactttattcctcttcaa |
45389986 |
T |
|
| Q |
219 |
tgtctaaaacttgtcactacttcaattgag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45389985 |
tgtctaaaacttgtcactacttcaattgag |
45389956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University