View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6125_low_12 (Length: 237)
Name: NF6125_low_12
Description: NF6125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6125_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 29141818 - 29142041
Alignment:
| Q |
1 |
tacaacattatcattttgtaacatgcacttgtgatttttatgcagatcgattaaattttgttaatgcataggggtagctttattttgtacgtttggagaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29141818 |
tacaacagtatcattttgtaacatgcacttgtgatttttatgcagattgattaaattttgttaatgcataggggtagctttattttgtacgtttagagaa |
29141917 |
T |
 |
| Q |
101 |
agtcacatttgattcatagcttttacttaccgacacaaaatgagttcgtttggtgtaactttaaagagaaatgttatctttgcagggtttcggctctttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29141918 |
agtcacatttgattcatagcttttacttaccgacacaaaatgagttcatttggtgtaactttaaagagaaatgttatctttgcagggtttcggctctttc |
29142017 |
T |
 |
| Q |
201 |
tgttgttgctaagtattattatat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29142018 |
tgttgttgctaagtattattatat |
29142041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 44 - 141
Target Start/End: Original strand, 34254650 - 34254747
Alignment:
| Q |
44 |
agatcgattaaattttgttaatgcataggggtagctttattttgtacgtttggagaaagtcacatttgattcatagcttttacttaccgacacaaaat |
141 |
Q |
| |
|
|||| |||| |||||| ||||||| | |||||||||| ||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
34254650 |
agattgattgaattttcttaatgctcaagggtagctttgttttgtatgtttggagaaagtcacatttgatacgtagcttttacttaccgacacaaaat |
34254747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 172
Target Start/End: Original strand, 29014420 - 29014476
Alignment:
| Q |
116 |
atagcttttacttaccgacacaaaatgagttcgtttggtgtaactttaaagagaaat |
172 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||| |||||||||||||| ||||| |
|
|
| T |
29014420 |
atagcttttacttaccgacactagatgagttagttcagtgtaactttaaagtgaaat |
29014476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 186
Target Start/End: Original strand, 37896888 - 37896941
Alignment:
| Q |
133 |
acacaaaatgagttcgtttggtgtaactttaaagagaaatgttatctttgcagg |
186 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
37896888 |
acacaaaatgagttagtttggtgtaactttaaactgaaatgttaacttcgcagg |
37896941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 188
Target Start/End: Original strand, 29115327 - 29115362
Alignment:
| Q |
153 |
gtgtaactttaaagagaaatgttatctttgcagggt |
188 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29115327 |
gtgtaactttaaacagaaatgttatctttgcagggt |
29115362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University