View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6125_low_13 (Length: 236)
Name: NF6125_low_13
Description: NF6125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6125_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 3657063 - 3656854
Alignment:
| Q |
17 |
aaacatatgataattttgtattcaagaaatcatgagcctgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatccttgt |
116 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3657063 |
aaacgtatgataatcttgtattaaagaaatcacgagcctgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatccttgt |
3656964 |
T |
 |
| Q |
117 |
agaggaagatattattacaaatccattatttgaatggtagaagagggaatgacgaaatggatcgtctaccttccccgcgggaaaggtatgccttatagcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
3656963 |
agaggaagatattattacaaatccattatttgaatggtagaagagggaatgacgaaatggatcgcctaccttccccgcgggaaaggtatgcctttcagcg |
3656864 |
T |
 |
| Q |
217 |
tctctgctcc |
226 |
Q |
| |
|
| |||||||| |
|
|
| T |
3656863 |
tttctgctcc |
3656854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 30 - 226
Target Start/End: Complemental strand, 3649049 - 3648840
Alignment:
| Q |
30 |
ttttgtattcaagaaatcatgagcctgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatccttgtagaggaagatatt |
129 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||| ||||| |
|
|
| T |
3649049 |
ttttgtattaaagaaatcatgagcgtgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatggttgcaaaggaaaatatt |
3648950 |
T |
 |
| Q |
130 |
attacaaatccat--------------tatttgaatggtagaagagggaatgacgaaatggatcgtctaccttccccgcgggaaaggtatgccttatagc |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3648949 |
gttacaaatccattatatttggtttaatatttgaatggtagaagaggg-atgacgaaatggatcgtctaccttccccgtgggaaaggtatgccttatagc |
3648851 |
T |
 |
| Q |
216 |
gtctctgctcc |
226 |
Q |
| |
|
|| |||||||| |
|
|
| T |
3648850 |
gtttctgctcc |
3648840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 3644479 - 3644423
Alignment:
| Q |
26 |
ataattttgtattcaagaaatcatgagcctgtctgcattgacaatagggtcatcttc |
82 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
3644479 |
ataattttgtattatagaaagcatgagcctctctgcactgacaaaagggtcatcttc |
3644423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 36164455 - 36164406
Alignment:
| Q |
17 |
aaacatatgataattttgtattcaagaaatcatgagcctgtctgcattga |
66 |
Q |
| |
|
|||| ||||||||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
36164455 |
aaacgtatgataattttgtattaaagaaagcatgagcctatctgcattga |
36164406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University