View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6125_low_14 (Length: 230)
Name: NF6125_low_14
Description: NF6125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6125_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 140
Target Start/End: Original strand, 34779396 - 34779519
Alignment:
| Q |
17 |
cagagaacacagccctttgaaattttgctgacagcttttggtaggactgaaattctgagggctgaacctgtttgattgccatcttaaagtgcttcattgt |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34779396 |
cagagaacacggccctttgaaattttgctgacagcttttggtaggactgaaattctgagggctgaacctgtttgattgccatcttaaagtgcttcattgt |
34779495 |
T |
|
| Q |
117 |
tacaacggaagcatcaaagctttc |
140 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34779496 |
tacaacggaagcatcaaagctttc |
34779519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 19 - 140
Target Start/End: Complemental strand, 34682979 - 34682858
Alignment:
| Q |
19 |
gagaacacagccctttgaaattttgctgacagcttttggtaggactgaaattctgagggctgaacctgtttgattgccatcttaaagtgcttcattgtta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||| ||||| ||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
34682979 |
gagaacacagccctttgaaattttgctgacaacttttgataggactgagtttctgtgggctgaacttgttcaattgccgtcttaaagtgcttcattgtta |
34682880 |
T |
|
| Q |
119 |
caacggaagcatcaaagctttc |
140 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
34682879 |
caacggaagcatcaaagttttc |
34682858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 4108064 - 4108113
Alignment:
| Q |
162 |
tatgtacatttatttcatcaatgttcctacatcaattatcatgagtaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4108064 |
tatgtacatttatttcatcaatgttcctacatgaattatcatgagtaaaa |
4108113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University