View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6126_high_5 (Length: 303)
Name: NF6126_high_5
Description: NF6126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6126_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 3 - 218
Target Start/End: Original strand, 17166259 - 17166474
Alignment:
| Q |
3 |
agcagaatcttgaaatgaccgtggagaaaggacccggcaagggaatgatgatagggcgaacacaatggttcacagcgaggaactcccccttcatcttttc |
102 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||| |||||||| || ||| ||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
17166259 |
agcaggatcctgaaatgatcgtggagaaaggactcggcaaggcaacgattatagggcgaacactatggttcacagcgaggaactcc---ttcatcttttc |
17166355 |
T |
 |
| Q |
103 |
tgcatcatgaaccttgacttcttc---gacatcttcatcaataaccgtcattttcccttccatatctgaaatttctcttgtgtccttcaaacaccctttc |
199 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||| ||| ||||||| |||||||||||| |||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17166356 |
tgcatcctcaaccttgacttcttctttgacatcttgatctataaccgccattttcccttctatatctgaaatttctcttgtctccttcaaacactctttc |
17166455 |
T |
 |
| Q |
200 |
aatggttctgcaatggacc |
218 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
17166456 |
aatggttctgccatggacc |
17166474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 217
Target Start/End: Complemental strand, 41109723 - 41109626
Alignment:
| Q |
120 |
cttcttcgacatcttcatcaataaccgtcattttcccttccatatctgaaatttctcttgtgtccttcaaacaccctttcaatggttctgcaatggac |
217 |
Q |
| |
|
|||| ||||||||||||| | || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41109723 |
cttcatcgacatcttcatagagaatcgtcattttcccttctatatctgaaatttctcttgtgtccttcaaacaccctttcaatggttctgtaatggac |
41109626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University