View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6128_high_7 (Length: 264)

Name: NF6128_high_7
Description: NF6128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6128_high_7
NF6128_high_7
[»] chr7 (2 HSPs)
chr7 (44-112)||(38584109-38584177)
chr7 (176-243)||(38583978-38584045)


Alignment Details
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 44 - 112
Target Start/End: Complemental strand, 38584177 - 38584109
Alignment:
44 gacaatcatcaaaattacgaaataaccaaccatatgaatctgaatgaacagtgacccacatgaagaagt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38584177 gacaatcatcaaaattacgaaataaccaaccatatgaatctgaatgaacagtgacccacatgaagaagt 38584109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 176 - 243
Target Start/End: Complemental strand, 38584045 - 38583978
Alignment:
176 tatagatcgaagagcttacacgtgtgaagacattcagatatagttgtaggttgtttgaacaaattgtt 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38584045 tatagatcgaagagcttacacgtgtgaagacattcagatatagttgtaggttgtttgaacaaattgtt 38583978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University