View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6129_low_6 (Length: 253)
Name: NF6129_low_6
Description: NF6129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6129_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 38712620 - 38712400
Alignment:
| Q |
19 |
tatttactcattttaaagttctaggttcaattgtatcttgttattccctctgctagattattattattatagtattttcaataccttagttctatactct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712620 |
tatttactcattttaaagttctaggttcaattgtatcttgttattccctctgctagattattattattatagtattttcaataccttagttctatactct |
38712521 |
T |
 |
| Q |
119 |
ttcttttaatttaatttttggttttctagaattgacaaggccttggtaaattgaagtcgccaccaccactagatactagtgaccaattttgtctcattgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38712520 |
ttcttttaatttaatttttggttttctagaattgacaagggcttggtaaattgaagtcaccaccaccactagacactagtgaccaattttgtctcattgt |
38712421 |
T |
 |
| Q |
219 |
gtttgatgtttcccagatatc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38712420 |
gtttgatgtttcccagatatc |
38712400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University