View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6130_low_8 (Length: 229)
Name: NF6130_low_8
Description: NF6130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6130_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 59 - 226
Target Start/End: Complemental strand, 8075410 - 8075243
Alignment:
| Q |
59 |
aattgaaatgatgtttttatttccggtattgaaatgatgttaacatgttagaacaaatatcacgtttctcttaattatggtattatcagggattgaagtt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8075410 |
aattgaaatgatgtttttatttccggtattgaaatgatgttaacatgttagaacaaatatcacgtttctcttaattatggtattatcagggattgaagtt |
8075311 |
T |
|
| Q |
159 |
gatgattctgtgtgtgtaaattgtaccttttatactacttttggtaagaatcacattgtatctctgct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
8075310 |
gatgattctgtgtgtgtaaattgtaccttttatactacttttggcaaggatcacattgtatctttgct |
8075243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University