View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_118 (Length: 249)
Name: NF6131_high_118
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_118 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 38 - 239
Target Start/End: Complemental strand, 2737956 - 2737755
Alignment:
| Q |
38 |
catttgagtatgtgtagcaggataaagtaggttgtctttaaatgtatactacttgttagttgtttcacgtttttagatatttagttctttctagtagtag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2737956 |
catttgagtatgtgtagcaggataaagtaggttctctttaaatgtatactacttgttagttgtttcacgtttttagatatttagttctttctagtagtag |
2737857 |
T |
 |
| Q |
138 |
ttaccgagaaagtagtggttgtagtcgggttggaaatttctgacttaaggtagatttaaattcattaattttaggaatggcaattttgtgaatccacctt |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2737856 |
ttaccgagaaagtagtggttgtagtcgtgttggaaatttctgacttaaggtagatttaaattcattaattttaggaatagcaattctgtgaatccacctt |
2737757 |
T |
 |
| Q |
238 |
tg |
239 |
Q |
| |
|
|| |
|
|
| T |
2737756 |
tg |
2737755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University