View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_123 (Length: 247)
Name: NF6131_high_123
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_123 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 47501374 - 47501148
Alignment:
| Q |
1 |
tggtatgcccatgaaacccaacaaaggagaacggatgcaaatgcatagaaggccatgaaagctgagtttatagcccatgttttcttcactaggcttccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47501374 |
tggtatgcccatgaaacccaacaaaggagaacggatgcaaatgcatagaaggccatgaaagctgagtttatagcccatgttttcttcactaggcttccgt |
47501275 |
T |
|
| Q |
101 |
aaagtatgacaagcccgggaatgctttgaagcccaaccattgttgctgctgttaactgccatgcgttgtcccctttgttcatccactctgggcttgcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47501274 |
aaagtatgacaagcccgggaatgctttgaagcccaaccattgttgctgctgttaattgccatgcgttgtcccctttgttcatccactctgggcttgcttc |
47501175 |
T |
|
| Q |
201 |
atcaggcaacaggtttgaaggtagctc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47501174 |
atcaggcaacaggtttgaaggtagctc |
47501148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 179
Target Start/End: Complemental strand, 31605872 - 31605700
Alignment:
| Q |
7 |
gcccatgaaacccaacaaaggagaacggatgcaaatgcatagaaggccatgaaagctgagtttatagcccatgttttcttcactaggcttccgtaaagta |
106 |
Q |
| |
|
|||||| |||||||||||| || || | ||||||||||| | |||||||||||| || |||| |||||| ||||||| || | ||| || || |||| |
|
|
| T |
31605872 |
gcccataaaacccaacaaactagtacagcagcaaatgcatatagggccatgaaagccgaatttacggcccattttttcttaaccatgctgccatagagta |
31605773 |
T |
|
| Q |
107 |
tgacaagcccgggaatgctttgaagcccaaccattgttgctgctgttaactgccatgcgttgtcccctttgtt |
179 |
Q |
| |
|
| |||||||| |||| ||||||| || || | |||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
31605772 |
ttacaagcccaggaacagtttgaaggcctactaatgttgctgctgttagttgccatgcattgtctgctttgtt |
31605700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University