View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_128 (Length: 243)
Name: NF6131_high_128
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_128 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 45460539 - 45460315
Alignment:
| Q |
1 |
tcattttctagtttaatgcaaaaatgggagctactctcttgattaataactcaagnnnnnnncattaattaacaccaagagaaatgnnnnnnntggcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
45460539 |
tcattttctagtttaatgcaaaaatgggagctactctcttgattaataactcaagaaaaaaacattaattaacaccaagagaaatgaaaaaaatggcata |
45460440 |
T |
|
| Q |
101 |
cttgttgcgttgccaatcttcaccatgtctctgaaaccaaccgtcacagctagactgaaaatcatcaataaccagttgacatcggagatgtaaatctggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460439 |
cttgttgcgttgccaatcttcaccatgtctctgaaaccaaccgtcacagctagactgaaaatcatcaataaccagttgacatcggagatgtaaatctggc |
45460340 |
T |
|
| Q |
201 |
catgtattgtttttgatgtgtgaat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45460339 |
catgtattgtttttgatgtgtgaat |
45460315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University