View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_130 (Length: 243)
Name: NF6131_high_130
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_130 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 11613497 - 11613735
Alignment:
| Q |
1 |
atgcatggatcgaggggaccaaatggcggcattatccggttctgcatcatactttatgcagagaggattacctggttctggaaaccaacatgagttgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613497 |
atgcatggatcgaggggaccaaatggcggcattatccggttctgcatcatactttatgcagagaggattacctggttctggaaaccaacatgagttgcat |
11613596 |
T |
|
| Q |
101 |
aattcgcctggtattcgtccaccgaataccaattcatcgtttcaatcaagcattggtggtggtggtactattggatccacgttgccgatggattcttctg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613597 |
aattcgcctggtattcgtccactgaataccaattcatcgtttcaatcaagcattggtggtggtggtactattggatccacgttgccgatggattcttctg |
11613696 |
T |
|
| Q |
201 |
gaattggatctcaatgtatcaatgtaggtgcttcttctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613697 |
gaattggatctcaatgtatcaatgtaggtgcttcttctg |
11613735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University