View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_134 (Length: 241)
Name: NF6131_high_134
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_134 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 27409080 - 27409235
Alignment:
| Q |
1 |
tcttattggacttatcatacactaacgaactgttgtgttttattgaatttcactaaattaggaagtcaacttacacacaacgcacacctctctacaatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
27409080 |
tcttattggacttatcatacactaacgaactgttgtgttttattgaatttcactaaattaggaagtcaacttaaacacaatgcacacctctctacaatga |
27409179 |
T |
|
| Q |
101 |
tataaaatacaggtccttgatacattggaaaacatttgcgcatacatgcattggct |
156 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27409180 |
tataaaatataggtccttgatacattgaaaaacatttgcgcatacatgcattggct |
27409235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 33421624 - 33421554
Alignment:
| Q |
153 |
ggcttatccataacaataagccattgattgtaatcacaacccgggaaaagcggagccatctcagcaagagg |
223 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
33421624 |
ggcttatcaataataataagccagtgattgtaatcacaaccagggaaaagcggagccatctcagcaggagg |
33421554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University