View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_136 (Length: 240)
Name: NF6131_high_136
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_136 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 40867262 - 40867040
Alignment:
| Q |
18 |
agatgcagccgatacatccccaccgttaatagtagcaccaaaggaaccaaatccacatgcaccagctgaaatgagttcaaaagagcataaatataagaga |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
40867262 |
agatgcagccgatacatccccaccattaatagtagcaccaaaggaaccaaatccacatgcaccagctgaaatgaattcaaaagagcataaatataaaaga |
40867163 |
T |
 |
| Q |
118 |
gaacatgtttacaaatatcatttcatgtttgcatttttgttattttttatcagttttcttactatctgtgccgttttcttcagagtttgggtaaaatgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40867162 |
gaacatgtttacaaatatcatttcatgtttgcatttttgttattttttatcagttttcttactatctgtgccgttttcttcagagtttgggtaaaatgat |
40867063 |
T |
 |
| Q |
218 |
gcatgagattgaacaaaacaatc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40867062 |
gcatgagattgaacaaaacaatc |
40867040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University